Review



step reverse transcriptase pcr kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Qiagen step reverse transcriptase pcr kit
    Step Reverse Transcriptase Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 6786 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/Reverse+transcriptase/us12624106-1010-13-18
    Average 97 stars, based on 6786 article reviews
    step reverse transcriptase pcr kit - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Dynamic Interplay Between miR-133a and RBMX During Dengue Virus Infection.
    Article Snippet: Viruses are obligate intracellular pathogens with limited genome capacity, relying entirely on host factors and cellular machinery for sustainable infection.. In the present study, we demonstrate that dengue infection modulates the expression of RBMX (an RNA‐binding protein) and miR‐133a.. Viral infection elevates the expression of the RBMX gene while downregulates the level of miR‐133a.

    Article Title: Augment proteasome inhibitor efficacy activates CD8 + T cell-mediated antitumor immunity in breast cancer
    Article Snippet: The band signals were developed with Clarity Western ECL Substrate (Bio-Rad) and quantified with ImageJ software (NIH). .. Total RNA was isolated from drug-treated cells via TRIzol (Invitrogen) and reverse transcribed into cDNA via a reverse transcriptase kit (Qiagen). qRT‒PCR was conducted at QuantStudio 7 (Applied Biosystems) with a FastStart SYBR Green Master Kit (Roche, Germany) using the primers listed in . .. Proteasome activity was detected via a Proteasome Activity Assay Kit (Abcam) as previously described.

    Article Title: Selection of optimal human myoblasts based on patient related factors influencing proliferation and differentiation capacity.
    Article Snippet: .. RNA was isolated with RNeasy Mini Kit (Qiagen GmbH, Hamburg) and then transcribed into cDNA with Reverse Transcriptase Kit (QuantiTect, Qiagen GmbH) as described before30. ..

    Article Title: Augment proteasome inhibitor efficacy activates CD8 + T cell-mediated antitumor immunity in breast cancer.
    Article Snippet: The band signals were developed with Clarity Western ECL Substrate (Bio-Rad) and quantified with ImageJ software (NIH). .. Total RNA was isolated from drug-treated cells via TRIzol (Invitrogen) and reverse transcribed into cDNA via a reverse transcriptase kit (Qiagen). qRT‒PCR was conducted at QuantStudio 7 (Applied Biosystems) with a FastStart SYBR Green Master Kit (Roche, Germany) using the primers listed in Table S3. .. Proteasome activity was detected via a Proteasome Activity Assay Kit (Abcam) as previously described.

    Article Title: TDP-43 pathology is linked to motor neuron loss but is independent of stress granules in vivo
    Article Snippet: Residual genomic DNA was removed using the TURBO DNA- free TM Kit (Invitrogen #AM1907). .. RNA concentration was measured and equal amounts of RNA were used to synthesize cDNA with a reverse transcriptase kit (Qiagen). cDNA was amplified using primers targeting Adnp2 cryptic exon (339 bp, F: CTTGACAACATCAGGAAGGTGC, R: TTGTCCGGTATCTCGCTTTCT), Synjbp2 cryptic exon (224 bp, F: CTCCAACGACAGTGGCATCT, R: TCTTCCTGAGGACCTCCGTT), Usp15 cryptic exon (356 bp, F: GGTCCCTCTACTCCTAAGTCCC, R: TGGCTGTT CATTGTTTCTTCCAG), and Sort1-17B (350 bp, F: CAAATGCCAAGGTGGGATGAA, R: TTGAATCCAAAGCCTCTACGCC) , . .. PCR was performed using Phusion Plus green Master Mix (Thermo Scientific #F632L) with a modified touchdown PCR protocol.

    Article Title: Augment proteasome inhibitor efficacy activates CD8 + T cell-mediated antitumor immunity in breast cancer
    Article Snippet: BCA Protein Assay Kit , Thermo Fisher Scientific , Cat #: A55864. .. Reverse Transcriptase kit , Qiagen , Cat #: 205311. .. FastStart SYBR Green Master Kit , Roche , Cat #: 12239264001.

    Article Title: Increased Dipeptidyl Peptidase‐4 Promotes Adipose Inflammation and Dysfunction in Mice Under Chronic Stress
    Article Snippet: For a quantitative real‐time polymerase chain reaction (qPCR) evaluation, whole RNA was harvested from SWAT with TRIZOL reagent (Invitrogen) according to the manufacturer's protocol. .. Subsequently, cDNAs were synthesized using a Reverse Transcriptase Kit (Zomanbio, Beijing, China) and subjected to a qPCR with the use of Power SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) [ ]. .. The gene expression levels were normalized to the housekeeping gene GAPDH, and we used an ABI 7300 Real‐Time PCR System (Applied Biosystems, Foster City, CA) to analyze the data.

    Incubation:

    Article Title: Dynamic Interplay Between miR-133a and RBMX During Dengue Virus Infection.
    Article Snippet: Viruses are obligate intracellular pathogens with limited genome capacity, relying entirely on host factors and cellular machinery for sustainable infection.. In the present study, we demonstrate that dengue infection modulates the expression of RBMX (an RNA‐binding protein) and miR‐133a.. Viral infection elevates the expression of the RBMX gene while downregulates the level of miR‐133a.

    Isolation:

    Article Title: Augment proteasome inhibitor efficacy activates CD8 + T cell-mediated antitumor immunity in breast cancer
    Article Snippet: The band signals were developed with Clarity Western ECL Substrate (Bio-Rad) and quantified with ImageJ software (NIH). .. Total RNA was isolated from drug-treated cells via TRIzol (Invitrogen) and reverse transcribed into cDNA via a reverse transcriptase kit (Qiagen). qRT‒PCR was conducted at QuantStudio 7 (Applied Biosystems) with a FastStart SYBR Green Master Kit (Roche, Germany) using the primers listed in . .. Proteasome activity was detected via a Proteasome Activity Assay Kit (Abcam) as previously described.

    Article Title: Selection of optimal human myoblasts based on patient related factors influencing proliferation and differentiation capacity.
    Article Snippet: .. RNA was isolated with RNeasy Mini Kit (Qiagen GmbH, Hamburg) and then transcribed into cDNA with Reverse Transcriptase Kit (QuantiTect, Qiagen GmbH) as described before30. ..

    Article Title: Augment proteasome inhibitor efficacy activates CD8 + T cell-mediated antitumor immunity in breast cancer.
    Article Snippet: The band signals were developed with Clarity Western ECL Substrate (Bio-Rad) and quantified with ImageJ software (NIH). .. Total RNA was isolated from drug-treated cells via TRIzol (Invitrogen) and reverse transcribed into cDNA via a reverse transcriptase kit (Qiagen). qRT‒PCR was conducted at QuantStudio 7 (Applied Biosystems) with a FastStart SYBR Green Master Kit (Roche, Germany) using the primers listed in Table S3. .. Proteasome activity was detected via a Proteasome Activity Assay Kit (Abcam) as previously described.

    SYBR Green Assay:

    Article Title: Augment proteasome inhibitor efficacy activates CD8 + T cell-mediated antitumor immunity in breast cancer
    Article Snippet: The band signals were developed with Clarity Western ECL Substrate (Bio-Rad) and quantified with ImageJ software (NIH). .. Total RNA was isolated from drug-treated cells via TRIzol (Invitrogen) and reverse transcribed into cDNA via a reverse transcriptase kit (Qiagen). qRT‒PCR was conducted at QuantStudio 7 (Applied Biosystems) with a FastStart SYBR Green Master Kit (Roche, Germany) using the primers listed in . .. Proteasome activity was detected via a Proteasome Activity Assay Kit (Abcam) as previously described.

    Article Title: Augment proteasome inhibitor efficacy activates CD8 + T cell-mediated antitumor immunity in breast cancer.
    Article Snippet: The band signals were developed with Clarity Western ECL Substrate (Bio-Rad) and quantified with ImageJ software (NIH). .. Total RNA was isolated from drug-treated cells via TRIzol (Invitrogen) and reverse transcribed into cDNA via a reverse transcriptase kit (Qiagen). qRT‒PCR was conducted at QuantStudio 7 (Applied Biosystems) with a FastStart SYBR Green Master Kit (Roche, Germany) using the primers listed in Table S3. .. Proteasome activity was detected via a Proteasome Activity Assay Kit (Abcam) as previously described.

    Article Title: Increased Dipeptidyl Peptidase‐4 Promotes Adipose Inflammation and Dysfunction in Mice Under Chronic Stress
    Article Snippet: For a quantitative real‐time polymerase chain reaction (qPCR) evaluation, whole RNA was harvested from SWAT with TRIZOL reagent (Invitrogen) according to the manufacturer's protocol. .. Subsequently, cDNAs were synthesized using a Reverse Transcriptase Kit (Zomanbio, Beijing, China) and subjected to a qPCR with the use of Power SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) [ ]. .. The gene expression levels were normalized to the housekeeping gene GAPDH, and we used an ABI 7300 Real‐Time PCR System (Applied Biosystems, Foster City, CA) to analyze the data.

    Concentration Assay:

    Article Title: TDP-43 pathology is linked to motor neuron loss but is independent of stress granules in vivo
    Article Snippet: Residual genomic DNA was removed using the TURBO DNA- free TM Kit (Invitrogen #AM1907). .. RNA concentration was measured and equal amounts of RNA were used to synthesize cDNA with a reverse transcriptase kit (Qiagen). cDNA was amplified using primers targeting Adnp2 cryptic exon (339 bp, F: CTTGACAACATCAGGAAGGTGC, R: TTGTCCGGTATCTCGCTTTCT), Synjbp2 cryptic exon (224 bp, F: CTCCAACGACAGTGGCATCT, R: TCTTCCTGAGGACCTCCGTT), Usp15 cryptic exon (356 bp, F: GGTCCCTCTACTCCTAAGTCCC, R: TGGCTGTT CATTGTTTCTTCCAG), and Sort1-17B (350 bp, F: CAAATGCCAAGGTGGGATGAA, R: TTGAATCCAAAGCCTCTACGCC) , . .. PCR was performed using Phusion Plus green Master Mix (Thermo Scientific #F632L) with a modified touchdown PCR protocol.

    Amplification:

    Article Title: TDP-43 pathology is linked to motor neuron loss but is independent of stress granules in vivo
    Article Snippet: Residual genomic DNA was removed using the TURBO DNA- free TM Kit (Invitrogen #AM1907). .. RNA concentration was measured and equal amounts of RNA were used to synthesize cDNA with a reverse transcriptase kit (Qiagen). cDNA was amplified using primers targeting Adnp2 cryptic exon (339 bp, F: CTTGACAACATCAGGAAGGTGC, R: TTGTCCGGTATCTCGCTTTCT), Synjbp2 cryptic exon (224 bp, F: CTCCAACGACAGTGGCATCT, R: TCTTCCTGAGGACCTCCGTT), Usp15 cryptic exon (356 bp, F: GGTCCCTCTACTCCTAAGTCCC, R: TGGCTGTT CATTGTTTCTTCCAG), and Sort1-17B (350 bp, F: CAAATGCCAAGGTGGGATGAA, R: TTGAATCCAAAGCCTCTACGCC) , . .. PCR was performed using Phusion Plus green Master Mix (Thermo Scientific #F632L) with a modified touchdown PCR protocol.

    Synthesized:

    Article Title: Increased Dipeptidyl Peptidase‐4 Promotes Adipose Inflammation and Dysfunction in Mice Under Chronic Stress
    Article Snippet: For a quantitative real‐time polymerase chain reaction (qPCR) evaluation, whole RNA was harvested from SWAT with TRIZOL reagent (Invitrogen) according to the manufacturer's protocol. .. Subsequently, cDNAs were synthesized using a Reverse Transcriptase Kit (Zomanbio, Beijing, China) and subjected to a qPCR with the use of Power SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) [ ]. .. The gene expression levels were normalized to the housekeeping gene GAPDH, and we used an ABI 7300 Real‐Time PCR System (Applied Biosystems, Foster City, CA) to analyze the data.

    Real-time Polymerase Chain Reaction:

    Article Title: Increased Dipeptidyl Peptidase‐4 Promotes Adipose Inflammation and Dysfunction in Mice Under Chronic Stress
    Article Snippet: For a quantitative real‐time polymerase chain reaction (qPCR) evaluation, whole RNA was harvested from SWAT with TRIZOL reagent (Invitrogen) according to the manufacturer's protocol. .. Subsequently, cDNAs were synthesized using a Reverse Transcriptase Kit (Zomanbio, Beijing, China) and subjected to a qPCR with the use of Power SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) [ ]. .. The gene expression levels were normalized to the housekeeping gene GAPDH, and we used an ABI 7300 Real‐Time PCR System (Applied Biosystems, Foster City, CA) to analyze the data.

    Polymerase Chain Reaction:

    Article Title: Increased Dipeptidyl Peptidase‐4 Promotes Adipose Inflammation and Dysfunction in Mice Under Chronic Stress
    Article Snippet: For a quantitative real‐time polymerase chain reaction (qPCR) evaluation, whole RNA was harvested from SWAT with TRIZOL reagent (Invitrogen) according to the manufacturer's protocol. .. Subsequently, cDNAs were synthesized using a Reverse Transcriptase Kit (Zomanbio, Beijing, China) and subjected to a qPCR with the use of Power SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) [ ]. .. The gene expression levels were normalized to the housekeeping gene GAPDH, and we used an ABI 7300 Real‐Time PCR System (Applied Biosystems, Foster City, CA) to analyze the data.

    other:

    Article Title: Augment proteasome inhibitor efficacy activates CD8 + T cell-mediated antitumor immunity in breast cancer.
    Article Snippet: Proteasome activity was detected via a Proteasome Activity Assay Kit (Abcam) as previously described.



    Similar Products

    97
    TaKaRa primescripttm reverse transcriptase reagent kit
    Primescripttm Reverse Transcriptase Reagent Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/PrimeScript+Reverse+Transcriptase/pm42133204-232-8-13
    Average 97 stars, based on 1 article reviews
    primescripttm reverse transcriptase reagent kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    99
    New England Biolabs m mulv reverse transcriptase kit
    M Mulv Reverse Transcriptase Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/M-MuLV+Reverse+Transcriptase/pm42106013-170-14-19
    Average 99 stars, based on 1 article reviews
    m mulv reverse transcriptase kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Accurate Biotechnology Co Ltd reverse transcriptase kit
    Reverse Transcriptase Kit, supplied by Accurate Biotechnology Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/evo+kit+m+mlv+reverse+transcription/pm42251831-140-13-16
    Average 86 stars, based on 1 article reviews
    reverse transcriptase kit - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Fisher Scientific superscripttm iv reverse transcriptase kit
    Superscripttm Iv Reverse Transcriptase Kit, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/m+mlv+reverse+transcriptase/bio_rxiv__64898__2026__05__19__724896-110-12-17
    Average 86 stars, based on 1 article reviews
    superscripttm iv reverse transcriptase kit - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    97
    TaKaRa prime script reverse transcriptase reagent kit
    Prime Script Reverse Transcriptase Reagent Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/PrimeScript+Reverse+Transcriptase/10__3390_slash_ijms27104354-179-30-36
    Average 97 stars, based on 1 article reviews
    prime script reverse transcriptase reagent kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    New England Biolabs m0277 reverse transcription kit
    M0277 Reverse Transcription Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/AMV+Reverse+Transcriptase/pm42121415-89-8-12
    Average 97 stars, based on 1 article reviews
    m0277 reverse transcription kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Qiagen step reverse transcriptase pcr kit
    Step Reverse Transcriptase Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/Reverse+transcriptase/us12624106-1010-13-18
    Average 97 stars, based on 1 article reviews
    step reverse transcriptase pcr kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribe reverse transcriptase kit
    Smartscribe Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/SMARTScribe+Reverse+Transcriptase/10__1021_slash_acsptsci__6c00117-175-37-41
    Average 96 stars, based on 1 article reviews
    smartscribe reverse transcriptase kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    Bio-Rad iscript reverse transcriptase 198
    Iscript Reverse Transcriptase 198, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/IScript+C+DNA+Synthesis+Kit/pm42095486-85-13-17
    Average 99 stars, based on 1 article reviews
    iscript reverse transcriptase 198 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    98
    New England Biolabs protoscript ii reverse transcriptase kit
    Protoscript Ii Reverse Transcriptase Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+transcriptase+kit/ProtoScript+II+Reverse+Transcriptase/bio_rxiv__64898__2026__04__30__721829-59-0-5
    Average 98 stars, based on 1 article reviews
    protoscript ii reverse transcriptase kit - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results